Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 1833469
End position: 1833492
Length: 24

DNA sequence
>NC_018513, from 1833469 to 1833492 (24 bp); Burkholderia cepacia GG4 GGCTGCGGTTGCGGCTGGGTCTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1833028-1833549	Sequence	GEM_1687 - hypothetical protein (Protein is coded in complementary strand; from 1833549 to 1833028)