Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 2157158
End position: 2157181
Length: 24

DNA sequence
>NC_018513, from 2157158 to 2157181 (24 bp); Burkholderia cepacia GG4 GCGATCACGATCGCGAGCACGATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2156222-2157895	Sequence	GEM_1985 - Methyl-accepting chemotaxis protein I (serine chemoreceptor protein) (Protein is coded in complementary strand; from 2157895 to 2156222)