Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 2171213
End position: 2171236
Length: 24

DNA sequence
>NC_018513, from 2171213 to 2171236 (24 bp); Burkholderia cepacia GG4 CGCGAACGCAAACGCGACCGCGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2169936-2171297	Sequence	GEM_1993 - peptidoglycan-binding LysM (Protein is coded in complementary strand; from 2171297 to 2169936)