Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 227924
End position: 227947
Length: 24

DNA sequence
>NC_018513, from 227924 to 227947 (24 bp); Burkholderia cepacia GG4 GCCGGCGCCCGCGGCGGCGCCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 226830-228227	Sequence	GEM_0209 - glucarate dehydratase (GDH) (GlucD) (Protein is coded in complementary strand; from 228227 to 226830)