Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 2469831
End position: 2469854
Length: 24

DNA sequence
>NC_018513, from 2469831 to 2469854 (24 bp); Burkholderia cepacia GG4 GCGCCGTCGCCGGCGCCCGCTCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2469808-2470704	Sequence	GEM_2258 - binding-protein-dependent transport system inner membrane protein