Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 2732483
End position: 2732506
Length: 24

DNA sequence
>NC_018513, from 2732483 to 2732506 (24 bp); Burkholderia cepacia GG4 GCGCCTGCGTCTGCTCCTGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2732380-2733027	Sequence	GEM_2495 - lipoprotein (Protein is coded in complementary strand; from 2733027 to 2732380)