Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 3204316
End position: 3204339
Length: 24

DNA sequence
>NC_018513, from 3204316 to 3204339 (24 bp); Burkholderia cepacia GG4 GCGCCTGCGCGTGCTCCTGGGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3204090-3204407	Sequence	GEM_2927 - hypothetical protein (Protein is coded in complementary strand; from 3204407 to 3204090)