Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 330847
End position: 330870
Length: 24

DNA sequence
>NC_018513, from 330847 to 330870 (24 bp); Burkholderia cepacia GG4 CGCGAGCGCGCGCGCCAGCGCGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 330206-331297	Sequence	GEM_0288 - spermidine/putrescine ABC transporter ATPase subuni (Protein is coded in complementary strand; from 331297 to 330206)