Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 3384169
End position: 3384192
Length: 24

DNA sequence
>NC_018513, from 3384169 to 3384192 (24 bp); Burkholderia cepacia GG4 CGAGCGCGATCGCGCGCGCGAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3383835-3384656	Sequence	GEM_3108 - ABC transporter (Protein is coded in complementary strand; from 3384656 to 3383835)