Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 398637
End position: 398660
Length: 24

DNA sequence
>NC_018513, from 398637 to 398660 (24 bp); Burkholderia cepacia GG4 TCGTGGTCATGGTCGTGATCGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 398262-399335	Sequence	GEM_0353 - cobalamin synthesis protein P47K (Protein is coded in complementary strand; from 399335 to 398262)