Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 418988
End position: 419011
Length: 24

DNA sequence
>NC_018513, from 418988 to 419011 (24 bp); Burkholderia cepacia GG4 GCGGCGGCGGCGGCAGCGGTGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 418040-419407	Sequence	GEM_0372 - flagellar hook-length control protein (Protein is coded in complementary strand; from 419407 to 418040)