Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 462412
End position: 462435
Length: 24

DNA sequence
>NC_018513, from 462412 to 462435 (24 bp); Burkholderia cepacia GG4 ATCAGCGCATTAGCGCATCAGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 462422-462862	Sequence	GEM_0414 - FlgN family protein (Protein is coded in complementary strand; from 462862 to 462422)