Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 514462
End position: 514485
Length: 24

DNA sequence
>NC_018513, from 514462 to 514485 (24 bp); Burkholderia cepacia GG4 CGGCGCCAGCGCCAGCGCCAGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 514301-515044	Sequence	GEM_0463 - short-chain dehydrogenase/reductase SDR (Protein is coded in complementary strand; from 515044 to 514301)