Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 556497
End position: 556520
Length: 24

DNA sequence
>NC_018513, from 556497 to 556520 (24 bp); Burkholderia cepacia GG4 AGCGGCAGCGGAAGCCGCAACGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 554925-556592	Sequence	GEM_0500 - Na+/H+ antiporter (Protein is coded in complementary strand; from 556592 to 554925)