Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 594140
End position: 594163
Length: 24

DNA sequence
>NC_018513, from 594140 to 594163 (24 bp); Burkholderia cepacia GG4 GCGCGAGCGCGGGCGTGAGCGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 593929-594849	Sequence	GEM_0533 - biotin--protein ligase (Protein is coded in complementary strand; from 594849 to 593929)