Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 820933
End position: 820956
Length: 24

DNA sequence
>NC_018513, from 820933 to 820956 (24 bp); Burkholderia cepacia GG4 GGCAGCGGCAGCGACAGCCGCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 820561-821403	Sequence	GEM_0741 - zinc metalloprotease (Protein is coded in complementary strand; from 821403 to 820561)