Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 958237
End position: 958260
Length: 24

DNA sequence
>NC_018513, from 958237 to 958260 (24 bp); Burkholderia cepacia GG4 GTCGCCGTCGTCGTCGCTGTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 957485-959011	Sequence	GEM_0866 - N-acetylmuramoyl-L-alanine amidase (Protein is coded in complementary strand; from 959011 to 957485)