Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 30570
End position: 30594
Length: 25

DNA sequence
>NC_018513, from 30570 to 30594 (25 bp); Burkholderia cepacia GG4 GGCGCGACGCGGCTCAGCGCGGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 30584-30901	Sequence	GEM_0028 - hypothetical protein (Protein is coded in complementary strand; from 30901 to 30584)