Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 1138389
End position: 1138415
Length: 27

DNA sequence
>NC_018513, from 1138389 to 1138415 (27 bp); Burkholderia cepacia GG4 CGCCGCGATCGCCGCGGTCGCCACGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1138262-1138645	Sequence	GEM_1041 - hypothetical protein (Protein is coded in complementary strand; from 1138645 to 1138262)