Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 2229289
End position: 2229315
Length: 27

DNA sequence
>NC_018513, from 2229289 to 2229315 (27 bp); Burkholderia cepacia GG4 GCAGCAGGCGCAGCCGGCCCAGCAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2227416-2229362	Sequence	GEM_2047 - hypothetical protein (Protein is coded in complementary strand; from 2229362 to 2227416)