Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 2349991
End position: 2350017
Length: 27

DNA sequence
>NC_018513, from 2349991 to 2350017 (27 bp); Burkholderia cepacia GG4 CACGAGCAACACGAGCGACACGAGAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2348720-2350039	Sequence	GEM_2148 - PAS/PAC sensor signal transduction histidine kinase (Protein is coded in complementary strand; from 2350039 to 2348720)