Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 2527102
End position: 2527128
Length: 27

DNA sequence
>NC_018513, from 2527102 to 2527128 (27 bp); Burkholderia cepacia GG4 GGCTCGCCGGGCTCGCCGGGCTCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2527086-2527775	Sequence	GEM_2308 - cytochrome c, class I (Protein is coded in complementary strand; from 2527775 to 2527086)