Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 979085
End position: 979111
Length: 27

DNA sequence
>NC_018513, from 979085 to 979111 (27 bp); Burkholderia cepacia GG4 CGAGCGCGACGAACGCGACGAGCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 979009-980175	Sequence	GEM_0888 - chromate ion transporter family chromate transporter (Protein is coded in complementary strand; from 980175 to 979009)