Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 1290360
End position: 1290389
Length: 30

DNA sequence
>NC_018513, from 1290360 to 1290389 (30 bp); Burkholderia cepacia GG4 GTGCCGGACTGGCCCGGACTGGCCCGGACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1290390-1291544	Sequence	GEM_1186 - aminotransferase (Protein is coded in complementary strand; from 1291544 to 1290390)