Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 1573657
End position: 1573686
Length: 30

DNA sequence
>NC_018513, from 1573657 to 1573686 (30 bp); Burkholderia cepacia GG4 GCCGCGCGCGCCCGCGCGGGGCGGCGCACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1573618-1574301	Sequence	GEM_1445 - wd40-like repeat protein (Protein is coded in complementary strand; from 1574301 to 1573618)