Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 171904
End position: 171933
Length: 30

DNA sequence
>NC_018513, from 171904 to 171933 (30 bp); Burkholderia cepacia GG4 AAAACGGAGCCCAACGGAGCCCAACGGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 171903-172046	Sequence	GEM_0152 - hypothetical protein (Protein is coded in complementary strand; from 172046 to 171903)