Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 2404657
End position: 2404686
Length: 30

DNA sequence
>NC_018513, from 2404657 to 2404686 (30 bp); Burkholderia cepacia GG4 GGCGCCGCACGCCGCCGCGCGGCGTCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2403483-2404754	Sequence	GEM_2202 - Beta-ureidopropionase (Protein is coded in complementary strand; from 2404754 to 2403483)