Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 2966410
End position: 2966442
Length: 33

DNA sequence
>NC_018513, from 2966410 to 2966442 (33 bp); Burkholderia cepacia GG4 CGCGCGTGTTCCGCGCGTTTCCCGCGCGTCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2966442-2966894	Sequence	GEM_2720 - Tfp pilus assembly protein PilE (Protein is coded in complementary strand; from 2966894 to 2966442)