Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 1916079
End position: 1916114
Length: 36

DNA sequence
>NC_018513, from 1916079 to 1916114 (36 bp); Burkholderia cepacia GG4 CTTGCCGCCGCACTGGCCGCTGCACTGGCCGCCGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1913988-1916285	Sequence	GEM_1772 - TonB-dependent siderophore receptor (Protein is coded in complementary strand; from 1916285 to 1913988)