Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 3028959
End position: 3028994
Length: 36

DNA sequence
>NC_018513, from 3028959 to 3028994 (36 bp); Burkholderia cepacia GG4 CGAGCAGCACGCCGCGCATCACGCCCGGCAGCACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3028841-3030757	Sequence	GEM_2771 - chorismate-binding protein (Protein is coded in complementary strand; from 3030757 to 3028841)