Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 767782
End position: 767817
Length: 36

DNA sequence
>NC_018513, from 767782 to 767817 (36 bp); Burkholderia cepacia GG4 CGCGGTCGAGCGCGCGGTTCAGCGCGCGGGCGAGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 766869-767831	Sequence	GEM_0695 - alpha/beta hydrolase fold-3 domain-containing protein
ORF... 767801-768643	Sequence	GEM_0696 - hypothetical protein (Protein is coded in complementary strand; from 768643 to 767801)