Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 1600821
End position: 1600865
Length: 45

DNA sequence
>NC_018513, from 1600821 to 1600865 (45 bp); Burkholderia cepacia GG4 GTTGTTGCGGATACGGTTGCGGCGGGTACGGTTGCTGCTGATACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1600553-1601725	Sequence	GEM_1474 - hypothetical protein (Protein is coded in complementary strand; from 1601725 to 1600553)