Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 2172320
End position: 2172364
Length: 45

DNA sequence
>NC_018513, from 2172320 to 2172364 (45 bp); Burkholderia cepacia GG4 CTGCCCCAGCGAAGGCTGCCGCAGCGTCGGCTGCCGCAGCAACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2172252-2172716	Sequence	GEM_1995 - hypothetical protein (Protein is coded in complementary strand; from 2172716 to 2172252)