Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 2556719
End position: 2556763
Length: 45

DNA sequence
>NC_018513, from 2556719 to 2556763 (45 bp); Burkholderia cepacia GG4 GCTTCGGCATGCTTGCCGTCCGCATGCTTGCCGTCCGCATGCTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2556467-2557987	Sequence	GEM_2323 - hypothetical protein (Protein is coded in complementary strand; from 2557987 to 2556467)