Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 2937471
End position: 2937515
Length: 45

DNA sequence
>NC_018513, from 2937471 to 2937515 (45 bp); Burkholderia cepacia GG4 GCCGCTCAGGCCGCTCAGGCCGCTCAGGCCGCTCAGGCCGCTCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2937513-2937914	Sequence	GEM_2694 - hypothetical protein (Protein is coded in complementary strand; from 2937914 to 2937513)