Sequence retrieval

Genome: Burkholderia cepacia GG4
Start position: 3197957
End position: 3198001
Length: 45

DNA sequence
>NC_018513, from 3197957 to 3198001 (45 bp); Burkholderia cepacia GG4 GCAGCAGCCTTCTTGGCAACGGTCTTCTTGGCAGCAACCTTCTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3197276-3198031	Sequence	GEM_2923 - hypothetical protein (Protein is coded in complementary strand; from 3198031 to 3197276)