Sequence retrieval

Genome: Listeria monocytogenes SLCC2372
Start position: 1890965
End position: 1890988
Length: 24

DNA sequence
>NC_018588, from 1890965 to 1890988 (24 bp); Listeria monocytogenes SLCC2372 GCATCAGCATCAGCATCAGCATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1889924-1892518	Sequence	LMOSLCC2372_1865 - cell wall surface anchor family protein (Protein is coded in complementary strand; from 1892518 to 1889924)