Sequence retrieval

Genome: Listeria monocytogenes SLCC2372
Start position: 2366177
End position: 2366200
Length: 24

DNA sequence
>NC_018588, from 2366177 to 2366200 (24 bp); Listeria monocytogenes SLCC2372 CAGAATCAAAATCATAATCAGAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2365843-2366364	Sequence	LMOSLCC2372_2324 - intracellular protease C56 (Protein is coded in complementary strand; from 2366364 to 2365843)