Sequence retrieval

Genome: Listeria monocytogenes SLCC2372
Start position: 2427346
End position: 2427369
Length: 24

DNA sequence
>NC_018588, from 2427346 to 2427369 (24 bp); Listeria monocytogenes SLCC2372 TTGCTTTTCCTTCTGCTTTTGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2426496-2427407	Sequence	LMOSLCC2372_2402 - indigoidine synthase A family protein (Protein is coded in complementary strand; from 2427407 to 2426496)