Sequence retrieval

Genome: Listeria monocytogenes SLCC2372
Start position: 2657545
End position: 2657568
Length: 24

DNA sequence
>NC_018588, from 2657545 to 2657568 (24 bp); Listeria monocytogenes SLCC2372 ATCATCATCATCTTCATCTTCATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2657456-2657992	Sequence	LMOSLCC2372_2624 rpoE DNA-directed RNA polymerase subunit delta (Protein is coded in complementary strand; from 2657992 to 2657456)