Sequence retrieval

Genome: Listeria monocytogenes SLCC2372
Start position: 2660158
End position: 2660181
Length: 24

DNA sequence
>NC_018588, from 2660158 to 2660181 (24 bp); Listeria monocytogenes SLCC2372 CTAATTCTGATTCTAATTGTAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2660025-2660474	Sequence	LMOSLCC2372_2626 - hypothetical protein (Protein is coded in complementary strand; from 2660474 to 2660025)