Sequence retrieval

Genome: Listeria monocytogenes SLCC2372
Start position: 2120819
End position: 2120851
Length: 33

DNA sequence
>NC_018588, from 2120819 to 2120851 (33 bp); Listeria monocytogenes SLCC2372 TTTGTTTAATGTTTCTTCAATGTTTGTAAAATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2120499-2121026	Sequence	LMOSLCC2372_2087 divIVA cell-division initiation protein (Protein is coded in complementary strand; from 2121026 to 2120499)