Sequence retrieval

Genome: Listeria monocytogenes SLCC2372
Start position: 1666363
End position: 1666398
Length: 36

DNA sequence
>NC_018588, from 1666363 to 1666398 (36 bp); Listeria monocytogenes SLCC2372 GCTGCTTCTTTTGCTGCTTCTTTCGCTGCTTTATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1666345-1666800	Sequence	LMOSLCC2372_1667 - hypothetical protein (Protein is coded in complementary strand; from 1666800 to 1666345)