Sequence retrieval

Genome: Listeria monocytogenes SLCC2372
Start position: 2396749
End position: 2396784
Length: 36

DNA sequence
>NC_018588, from 2396749 to 2396784 (36 bp); Listeria monocytogenes SLCC2372 ATTTTTCTGATTCTTTTTCTGGTTCTTTTTCTGGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2396703-2396882	Sequence	LMOSLCC2372_2355 - hypothetical protein (Protein is coded in complementary strand; from 2396882 to 2396703)