Sequence retrieval

Genome: Listeria monocytogenes SLCC2372
Start position: 618117
End position: 618152
Length: 36

DNA sequence
>NC_018588, from 618117 to 618152 (36 bp); Listeria monocytogenes SLCC2372 TTTGTATTTGTATTTGTATTTGTATTTGTATTTGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 617649-619109	Sequence	LMOSLCC2372_0591 iap cell wall hydrolases A (Protein is coded in complementary strand; from 619109 to 617649)