Sequence retrieval

Genome: Listeria monocytogenes SLCC2372
Start position: 709016
End position: 709055
Length: 40

DNA sequence
>NC_018588, from 709016 to 709055 (40 bp); Listeria monocytogenes SLCC2372 TTTTTTCTTTTTTTGTATTTTTTTGTGTTTTTCTTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 708553-709473	Sequence	LMOSLCC2372_0686 mogR motility gene repressor (Protein is coded in complementary strand; from 709473 to 708553)