Sequence retrieval

Genome: Actinobacillus suis H91-0380
Start position: 1195088
End position: 1195119
Length: 32

DNA sequence
>NC_018690, from 1195088 to 1195119 (32 bp); Actinobacillus suis H91-0380 AATCAATCAATCAATCAATCAATCAATCAATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 1195111-1195986	Sequence	ASU2_05400 - silent information regulator protein sir2 (Protein is coded in complementary strand; from 1195986 to 1195111)