Sequence retrieval

Genome: Actinobacillus suis H91-0380
Start position: 565550
End position: 565584
Length: 35

DNA sequence
>NC_018690, from 565550 to 565584 (35 bp); Actinobacillus suis H91-0380 GCATTGCATTGCATTGCATTGCATTGCATTGCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 564832-565638	Sequence	ASU2_02550 - phage protein (Protein is coded in complementary strand; from 565638 to 564832)