Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 947357
End position: 947380
Length: 24

DNA sequence
>NC_018828, from 947357 to 947380 (24 bp); Bordetella parapertussis Bpp5 GGCCCAGGCGCAGGCGCAGGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 946561-948849	Sequence	BN117_0870 maeB NADP-dependent malic enzyme (Protein is coded in complementary strand; from 948849 to 946561)