Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 3306530
End position: 3306556
Length: 27

DNA sequence
>NC_018828, from 3306530 to 3306556 (27 bp); Bordetella parapertussis Bpp5 GCCCAGGGCGCCCAGCGCGCCCAGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3305838-3307124	Sequence	BN117_3067 - transport protein (Protein is coded in complementary strand; from 3307124 to 3305838)